ID: 1052056222

View in Genome Browser
Species Human (GRCh38)
Location 9:23910724-23910746
Sequence ACAATACAGCCTTGAACTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052056222_1052056226 20 Left 1052056222 9:23910724-23910746 CCGTGAGTTCAAGGCTGTATTGT No data
Right 1052056226 9:23910767-23910789 TAGCCACTGCATTCTAGCCTGGG 0: 11
1: 224
2: 2634
3: 30756
4: 209462
1052056222_1052056225 19 Left 1052056222 9:23910724-23910746 CCGTGAGTTCAAGGCTGTATTGT No data
Right 1052056225 9:23910766-23910788 ATAGCCACTGCATTCTAGCCTGG 0: 10
1: 171
2: 905
3: 4564
4: 39795
1052056222_1052056227 21 Left 1052056222 9:23910724-23910746 CCGTGAGTTCAAGGCTGTATTGT No data
Right 1052056227 9:23910768-23910790 AGCCACTGCATTCTAGCCTGGGG 0: 3
1: 35
2: 571
3: 5402
4: 7480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052056222 Original CRISPR ACAATACAGCCTTGAACTCA CGG (reversed) Intergenic
No off target data available for this crispr