ID: 1052056223

View in Genome Browser
Species Human (GRCh38)
Location 9:23910747-23910769
Sequence CTATTCACAAGCATGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052056223_1052056227 -2 Left 1052056223 9:23910747-23910769 CCTACCATCATGCTTGTGAATAG No data
Right 1052056227 9:23910768-23910790 AGCCACTGCATTCTAGCCTGGGG 0: 3
1: 35
2: 571
3: 5402
4: 7480
1052056223_1052056225 -4 Left 1052056223 9:23910747-23910769 CCTACCATCATGCTTGTGAATAG No data
Right 1052056225 9:23910766-23910788 ATAGCCACTGCATTCTAGCCTGG 0: 10
1: 171
2: 905
3: 4564
4: 39795
1052056223_1052056226 -3 Left 1052056223 9:23910747-23910769 CCTACCATCATGCTTGTGAATAG No data
Right 1052056226 9:23910767-23910789 TAGCCACTGCATTCTAGCCTGGG 0: 11
1: 224
2: 2634
3: 30756
4: 209462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052056223 Original CRISPR CTATTCACAAGCATGATGGT AGG (reversed) Intergenic
No off target data available for this crispr