ID: 1052056225

View in Genome Browser
Species Human (GRCh38)
Location 9:23910766-23910788
Sequence ATAGCCACTGCATTCTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45445
Summary {0: 10, 1: 171, 2: 905, 3: 4564, 4: 39795}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052056222_1052056225 19 Left 1052056222 9:23910724-23910746 CCGTGAGTTCAAGGCTGTATTGT No data
Right 1052056225 9:23910766-23910788 ATAGCCACTGCATTCTAGCCTGG 0: 10
1: 171
2: 905
3: 4564
4: 39795
1052056221_1052056225 20 Left 1052056221 9:23910723-23910745 CCCGTGAGTTCAAGGCTGTATTG No data
Right 1052056225 9:23910766-23910788 ATAGCCACTGCATTCTAGCCTGG 0: 10
1: 171
2: 905
3: 4564
4: 39795
1052056224_1052056225 -8 Left 1052056224 9:23910751-23910773 CCATCATGCTTGTGAATAGCCAC No data
Right 1052056225 9:23910766-23910788 ATAGCCACTGCATTCTAGCCTGG 0: 10
1: 171
2: 905
3: 4564
4: 39795
1052056223_1052056225 -4 Left 1052056223 9:23910747-23910769 CCTACCATCATGCTTGTGAATAG No data
Right 1052056225 9:23910766-23910788 ATAGCCACTGCATTCTAGCCTGG 0: 10
1: 171
2: 905
3: 4564
4: 39795

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052056225 Original CRISPR ATAGCCACTGCATTCTAGCC TGG Intergenic
Too many off-targets to display for this crispr