ID: 1052056226

View in Genome Browser
Species Human (GRCh38)
Location 9:23910767-23910789
Sequence TAGCCACTGCATTCTAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243087
Summary {0: 11, 1: 224, 2: 2634, 3: 30756, 4: 209462}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052056223_1052056226 -3 Left 1052056223 9:23910747-23910769 CCTACCATCATGCTTGTGAATAG No data
Right 1052056226 9:23910767-23910789 TAGCCACTGCATTCTAGCCTGGG 0: 11
1: 224
2: 2634
3: 30756
4: 209462
1052056224_1052056226 -7 Left 1052056224 9:23910751-23910773 CCATCATGCTTGTGAATAGCCAC No data
Right 1052056226 9:23910767-23910789 TAGCCACTGCATTCTAGCCTGGG 0: 11
1: 224
2: 2634
3: 30756
4: 209462
1052056221_1052056226 21 Left 1052056221 9:23910723-23910745 CCCGTGAGTTCAAGGCTGTATTG No data
Right 1052056226 9:23910767-23910789 TAGCCACTGCATTCTAGCCTGGG 0: 11
1: 224
2: 2634
3: 30756
4: 209462
1052056222_1052056226 20 Left 1052056222 9:23910724-23910746 CCGTGAGTTCAAGGCTGTATTGT No data
Right 1052056226 9:23910767-23910789 TAGCCACTGCATTCTAGCCTGGG 0: 11
1: 224
2: 2634
3: 30756
4: 209462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052056226 Original CRISPR TAGCCACTGCATTCTAGCCT GGG Intergenic
Too many off-targets to display for this crispr