ID: 1052056227

View in Genome Browser
Species Human (GRCh38)
Location 9:23910768-23910790
Sequence AGCCACTGCATTCTAGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13491
Summary {0: 3, 1: 35, 2: 571, 3: 5402, 4: 7480}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052056223_1052056227 -2 Left 1052056223 9:23910747-23910769 CCTACCATCATGCTTGTGAATAG No data
Right 1052056227 9:23910768-23910790 AGCCACTGCATTCTAGCCTGGGG 0: 3
1: 35
2: 571
3: 5402
4: 7480
1052056222_1052056227 21 Left 1052056222 9:23910724-23910746 CCGTGAGTTCAAGGCTGTATTGT No data
Right 1052056227 9:23910768-23910790 AGCCACTGCATTCTAGCCTGGGG 0: 3
1: 35
2: 571
3: 5402
4: 7480
1052056224_1052056227 -6 Left 1052056224 9:23910751-23910773 CCATCATGCTTGTGAATAGCCAC No data
Right 1052056227 9:23910768-23910790 AGCCACTGCATTCTAGCCTGGGG 0: 3
1: 35
2: 571
3: 5402
4: 7480
1052056221_1052056227 22 Left 1052056221 9:23910723-23910745 CCCGTGAGTTCAAGGCTGTATTG No data
Right 1052056227 9:23910768-23910790 AGCCACTGCATTCTAGCCTGGGG 0: 3
1: 35
2: 571
3: 5402
4: 7480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052056227 Original CRISPR AGCCACTGCATTCTAGCCTG GGG Intergenic
Too many off-targets to display for this crispr