ID: 1052057028

View in Genome Browser
Species Human (GRCh38)
Location 9:23917903-23917925
Sequence TAACATACACAACCCGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052057028_1052057029 -9 Left 1052057028 9:23917903-23917925 CCTTGAACGGGTTGTGTATGTTA No data
Right 1052057029 9:23917917-23917939 TGTATGTTAAAAAGATGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052057028 Original CRISPR TAACATACACAACCCGTTCA AGG (reversed) Intergenic
No off target data available for this crispr