ID: 1052057860

View in Genome Browser
Species Human (GRCh38)
Location 9:23923786-23923808
Sequence GAGGCTTATCATTACTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052057850_1052057860 26 Left 1052057850 9:23923737-23923759 CCTTTGAAGATGTCTTTGATTAT No data
Right 1052057860 9:23923786-23923808 GAGGCTTATCATTACTAGGAAGG No data
1052057856_1052057860 1 Left 1052057856 9:23923762-23923784 CCTTCTGGGCAGGGGAGATTAGA 0: 90
1: 51
2: 73
3: 48
4: 226
Right 1052057860 9:23923786-23923808 GAGGCTTATCATTACTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052057860 Original CRISPR GAGGCTTATCATTACTAGGA AGG Intergenic
No off target data available for this crispr