ID: 1052058250

View in Genome Browser
Species Human (GRCh38)
Location 9:23926842-23926864
Sequence AAGGTTGTACTAAAAACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052058250_1052058255 21 Left 1052058250 9:23926842-23926864 CCATGTGTTTTTAGTACAACCTT No data
Right 1052058255 9:23926886-23926908 TGTTTTTCTGACCTGGAAGGTGG No data
1052058250_1052058253 14 Left 1052058250 9:23926842-23926864 CCATGTGTTTTTAGTACAACCTT No data
Right 1052058253 9:23926879-23926901 ACATTTCTGTTTTTCTGACCTGG No data
1052058250_1052058254 18 Left 1052058250 9:23926842-23926864 CCATGTGTTTTTAGTACAACCTT No data
Right 1052058254 9:23926883-23926905 TTCTGTTTTTCTGACCTGGAAGG No data
1052058250_1052058256 30 Left 1052058250 9:23926842-23926864 CCATGTGTTTTTAGTACAACCTT No data
Right 1052058256 9:23926895-23926917 GACCTGGAAGGTGGCTTTGCTGG No data
1052058250_1052058251 -9 Left 1052058250 9:23926842-23926864 CCATGTGTTTTTAGTACAACCTT No data
Right 1052058251 9:23926856-23926878 TACAACCTTAATTTAGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052058250 Original CRISPR AAGGTTGTACTAAAAACACA TGG (reversed) Intergenic