ID: 1052058252

View in Genome Browser
Species Human (GRCh38)
Location 9:23926861-23926883
Sequence AATGTCCACAGACTAAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052058252_1052058256 11 Left 1052058252 9:23926861-23926883 CCTTAATTTAGTCTGTGGACATT No data
Right 1052058256 9:23926895-23926917 GACCTGGAAGGTGGCTTTGCTGG No data
1052058252_1052058261 26 Left 1052058252 9:23926861-23926883 CCTTAATTTAGTCTGTGGACATT No data
Right 1052058261 9:23926910-23926932 TTTGCTGGTAGGGTATCTGGAGG No data
1052058252_1052058259 16 Left 1052058252 9:23926861-23926883 CCTTAATTTAGTCTGTGGACATT No data
Right 1052058259 9:23926900-23926922 GGAAGGTGGCTTTGCTGGTAGGG No data
1052058252_1052058255 2 Left 1052058252 9:23926861-23926883 CCTTAATTTAGTCTGTGGACATT No data
Right 1052058255 9:23926886-23926908 TGTTTTTCTGACCTGGAAGGTGG No data
1052058252_1052058260 23 Left 1052058252 9:23926861-23926883 CCTTAATTTAGTCTGTGGACATT No data
Right 1052058260 9:23926907-23926929 GGCTTTGCTGGTAGGGTATCTGG No data
1052058252_1052058254 -1 Left 1052058252 9:23926861-23926883 CCTTAATTTAGTCTGTGGACATT No data
Right 1052058254 9:23926883-23926905 TTCTGTTTTTCTGACCTGGAAGG No data
1052058252_1052058258 15 Left 1052058252 9:23926861-23926883 CCTTAATTTAGTCTGTGGACATT No data
Right 1052058258 9:23926899-23926921 TGGAAGGTGGCTTTGCTGGTAGG No data
1052058252_1052058253 -5 Left 1052058252 9:23926861-23926883 CCTTAATTTAGTCTGTGGACATT No data
Right 1052058253 9:23926879-23926901 ACATTTCTGTTTTTCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052058252 Original CRISPR AATGTCCACAGACTAAATTA AGG (reversed) Intergenic