ID: 1052058256

View in Genome Browser
Species Human (GRCh38)
Location 9:23926895-23926917
Sequence GACCTGGAAGGTGGCTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052058250_1052058256 30 Left 1052058250 9:23926842-23926864 CCATGTGTTTTTAGTACAACCTT No data
Right 1052058256 9:23926895-23926917 GACCTGGAAGGTGGCTTTGCTGG No data
1052058252_1052058256 11 Left 1052058252 9:23926861-23926883 CCTTAATTTAGTCTGTGGACATT No data
Right 1052058256 9:23926895-23926917 GACCTGGAAGGTGGCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052058256 Original CRISPR GACCTGGAAGGTGGCTTTGC TGG Intergenic
No off target data available for this crispr