ID: 1052061444

View in Genome Browser
Species Human (GRCh38)
Location 9:23965829-23965851
Sequence CCTTCAGATGGGTTTTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052061438_1052061444 23 Left 1052061438 9:23965783-23965805 CCTCATCTTTGTGGATTTATCTA No data
Right 1052061444 9:23965829-23965851 CCTTCAGATGGGTTTTTGTGTGG No data
1052061440_1052061444 0 Left 1052061440 9:23965806-23965828 CCTTTGTTCTTTGATGTTGGTGA No data
Right 1052061444 9:23965829-23965851 CCTTCAGATGGGTTTTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052061444 Original CRISPR CCTTCAGATGGGTTTTTGTG TGG Intergenic