ID: 1052063348

View in Genome Browser
Species Human (GRCh38)
Location 9:23987299-23987321
Sequence GGGCCTTAAGGAACATCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052063341_1052063348 20 Left 1052063341 9:23987256-23987278 CCAGGCCAGGCAGCATTTACCAC 0: 13
1: 129
2: 300
3: 420
4: 620
Right 1052063348 9:23987299-23987321 GGGCCTTAAGGAACATCAGAGGG No data
1052063340_1052063348 21 Left 1052063340 9:23987255-23987277 CCCAGGCCAGGCAGCATTTACCA 0: 13
1: 143
2: 335
3: 449
4: 717
Right 1052063348 9:23987299-23987321 GGGCCTTAAGGAACATCAGAGGG No data
1052063342_1052063348 15 Left 1052063342 9:23987261-23987283 CCAGGCAGCATTTACCACAAGCT 0: 28
1: 260
2: 435
3: 488
4: 665
Right 1052063348 9:23987299-23987321 GGGCCTTAAGGAACATCAGAGGG No data
1052063343_1052063348 1 Left 1052063343 9:23987275-23987297 CCACAAGCTGACTTAAGAGTCTT No data
Right 1052063348 9:23987299-23987321 GGGCCTTAAGGAACATCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052063348 Original CRISPR GGGCCTTAAGGAACATCAGA GGG Intergenic
No off target data available for this crispr