ID: 1052069708

View in Genome Browser
Species Human (GRCh38)
Location 9:24067251-24067273
Sequence GTGCAAGGGCAGAAAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052069698_1052069708 20 Left 1052069698 9:24067208-24067230 CCATAGAACTTCATTCCTCTGCC No data
Right 1052069708 9:24067251-24067273 GTGCAAGGGCAGAAAGAGCCAGG No data
1052069705_1052069708 -1 Left 1052069705 9:24067229-24067251 CCTGTCAAGGGGGATTTGGCTAG No data
Right 1052069708 9:24067251-24067273 GTGCAAGGGCAGAAAGAGCCAGG No data
1052069703_1052069708 5 Left 1052069703 9:24067223-24067245 CCTCTGCCTGTCAAGGGGGATTT No data
Right 1052069708 9:24067251-24067273 GTGCAAGGGCAGAAAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052069708 Original CRISPR GTGCAAGGGCAGAAAGAGCC AGG Intergenic
No off target data available for this crispr