ID: 1052070444

View in Genome Browser
Species Human (GRCh38)
Location 9:24075157-24075179
Sequence CTGCTTACCTGGATGTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052070444_1052070446 0 Left 1052070444 9:24075157-24075179 CCTCTTTACATCCAGGTAAGCAG No data
Right 1052070446 9:24075180-24075202 CAAGATTAGTACTAGCAGTGAGG No data
1052070444_1052070448 20 Left 1052070444 9:24075157-24075179 CCTCTTTACATCCAGGTAAGCAG No data
Right 1052070448 9:24075200-24075222 AGGGTTTGAAAGCAGAAGCAAGG No data
1052070444_1052070447 1 Left 1052070444 9:24075157-24075179 CCTCTTTACATCCAGGTAAGCAG No data
Right 1052070447 9:24075181-24075203 AAGATTAGTACTAGCAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052070444 Original CRISPR CTGCTTACCTGGATGTAAAG AGG (reversed) Intergenic
No off target data available for this crispr