ID: 1052076348

View in Genome Browser
Species Human (GRCh38)
Location 9:24145278-24145300
Sequence CTCAGCAGTGATTTGTAATC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052076346_1052076348 1 Left 1052076346 9:24145254-24145276 CCTTGCAATATCTTCTGAATGTC No data
Right 1052076348 9:24145278-24145300 CTCAGCAGTGATTTGTAATCGGG No data
1052076345_1052076348 2 Left 1052076345 9:24145253-24145275 CCCTTGCAATATCTTCTGAATGT No data
Right 1052076348 9:24145278-24145300 CTCAGCAGTGATTTGTAATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052076348 Original CRISPR CTCAGCAGTGATTTGTAATC GGG Intergenic
No off target data available for this crispr