ID: 1052079090

View in Genome Browser
Species Human (GRCh38)
Location 9:24180684-24180706
Sequence GTCCATTTTAGTCATGGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052079087_1052079090 -7 Left 1052079087 9:24180668-24180690 CCTGAGCTGTACTTTGGTCCATT No data
Right 1052079090 9:24180684-24180706 GTCCATTTTAGTCATGGCTAGGG No data
1052079084_1052079090 8 Left 1052079084 9:24180653-24180675 CCTCTGAAGCCATGGCCTGAGCT 0: 152
1: 580
2: 1054
3: 1229
4: 1499
Right 1052079090 9:24180684-24180706 GTCCATTTTAGTCATGGCTAGGG No data
1052079081_1052079090 28 Left 1052079081 9:24180633-24180655 CCAAGGCTTGGGGCTTGCACCCT 0: 635
1: 1548
2: 1761
3: 1287
4: 1041
Right 1052079090 9:24180684-24180706 GTCCATTTTAGTCATGGCTAGGG No data
1052079085_1052079090 -1 Left 1052079085 9:24180662-24180684 CCATGGCCTGAGCTGTACTTTGG No data
Right 1052079090 9:24180684-24180706 GTCCATTTTAGTCATGGCTAGGG No data
1052079083_1052079090 9 Left 1052079083 9:24180652-24180674 CCCTCTGAAGCCATGGCCTGAGC 0: 167
1: 554
2: 1007
3: 1214
4: 1360
Right 1052079090 9:24180684-24180706 GTCCATTTTAGTCATGGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052079090 Original CRISPR GTCCATTTTAGTCATGGCTA GGG Intergenic
No off target data available for this crispr