ID: 1052082315

View in Genome Browser
Species Human (GRCh38)
Location 9:24222371-24222393
Sequence CTGTGAATAGGCAGAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052082315_1052082322 23 Left 1052082315 9:24222371-24222393 CCATCCTCTCTGCCTATTCACAG No data
Right 1052082322 9:24222417-24222439 TTGCATTGCTGGGCTAAAATAGG No data
1052082315_1052082325 29 Left 1052082315 9:24222371-24222393 CCATCCTCTCTGCCTATTCACAG No data
Right 1052082325 9:24222423-24222445 TGCTGGGCTAAAATAGGGCTGGG No data
1052082315_1052082323 24 Left 1052082315 9:24222371-24222393 CCATCCTCTCTGCCTATTCACAG No data
Right 1052082323 9:24222418-24222440 TGCATTGCTGGGCTAAAATAGGG No data
1052082315_1052082324 28 Left 1052082315 9:24222371-24222393 CCATCCTCTCTGCCTATTCACAG No data
Right 1052082324 9:24222422-24222444 TTGCTGGGCTAAAATAGGGCTGG No data
1052082315_1052082320 12 Left 1052082315 9:24222371-24222393 CCATCCTCTCTGCCTATTCACAG No data
Right 1052082320 9:24222406-24222428 CATGTTTATTGTTGCATTGCTGG No data
1052082315_1052082321 13 Left 1052082315 9:24222371-24222393 CCATCCTCTCTGCCTATTCACAG No data
Right 1052082321 9:24222407-24222429 ATGTTTATTGTTGCATTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052082315 Original CRISPR CTGTGAATAGGCAGAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr