ID: 1052085755

View in Genome Browser
Species Human (GRCh38)
Location 9:24263673-24263695
Sequence CAGTTTTACCACAGAAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052085755_1052085757 15 Left 1052085755 9:24263673-24263695 CCTGAGTTTCTGTGGTAAAACTG No data
Right 1052085757 9:24263711-24263733 CCAATTGTTTAAAATAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052085755 Original CRISPR CAGTTTTACCACAGAAACTC AGG (reversed) Intergenic
No off target data available for this crispr