ID: 1052092802

View in Genome Browser
Species Human (GRCh38)
Location 9:24350072-24350094
Sequence ATGGAAAAGGGCCATTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052092802_1052092810 23 Left 1052092802 9:24350072-24350094 CCCATAAAATGGCCCTTTTCCAT No data
Right 1052092810 9:24350118-24350140 TTAGAACTGTTGGAAAATAATGG No data
1052092802_1052092809 13 Left 1052092802 9:24350072-24350094 CCCATAAAATGGCCCTTTTCCAT No data
Right 1052092809 9:24350108-24350130 CACAATGAAATTAGAACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052092802 Original CRISPR ATGGAAAAGGGCCATTTTAT GGG (reversed) Intergenic
No off target data available for this crispr