ID: 1052092809

View in Genome Browser
Species Human (GRCh38)
Location 9:24350108-24350130
Sequence CACAATGAAATTAGAACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052092803_1052092809 12 Left 1052092803 9:24350073-24350095 CCATAAAATGGCCCTTTTCCATC No data
Right 1052092809 9:24350108-24350130 CACAATGAAATTAGAACTGTTGG No data
1052092807_1052092809 -6 Left 1052092807 9:24350091-24350113 CCATCTGGTAAATGTTCCACAAT No data
Right 1052092809 9:24350108-24350130 CACAATGAAATTAGAACTGTTGG No data
1052092806_1052092809 0 Left 1052092806 9:24350085-24350107 CCTTTTCCATCTGGTAAATGTTC No data
Right 1052092809 9:24350108-24350130 CACAATGAAATTAGAACTGTTGG No data
1052092801_1052092809 20 Left 1052092801 9:24350065-24350087 CCAAAAGCCCATAAAATGGCCCT No data
Right 1052092809 9:24350108-24350130 CACAATGAAATTAGAACTGTTGG No data
1052092802_1052092809 13 Left 1052092802 9:24350072-24350094 CCCATAAAATGGCCCTTTTCCAT No data
Right 1052092809 9:24350108-24350130 CACAATGAAATTAGAACTGTTGG No data
1052092805_1052092809 1 Left 1052092805 9:24350084-24350106 CCCTTTTCCATCTGGTAAATGTT No data
Right 1052092809 9:24350108-24350130 CACAATGAAATTAGAACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052092809 Original CRISPR CACAATGAAATTAGAACTGT TGG Intergenic
No off target data available for this crispr