ID: 1052093881

View in Genome Browser
Species Human (GRCh38)
Location 9:24361733-24361755
Sequence AGGGAGAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052093875_1052093881 14 Left 1052093875 9:24361696-24361718 CCATGTAGTACAGAGAGAGAATT No data
Right 1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG No data
1052093874_1052093881 24 Left 1052093874 9:24361686-24361708 CCAGCAGTGGCCATGTAGTACAG No data
Right 1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052093881 Original CRISPR AGGGAGAGCACAGTGATTGT GGG Intergenic