ID: 1052094677

View in Genome Browser
Species Human (GRCh38)
Location 9:24369747-24369769
Sequence ACTAGGTAGGGCCTCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052094677_1052094684 17 Left 1052094677 9:24369747-24369769 CCAGCTGGGAGGCCCTACCTAGT No data
Right 1052094684 9:24369787-24369809 GGCACCTTTAAAAAGCAGTCTGG No data
1052094677_1052094683 -4 Left 1052094677 9:24369747-24369769 CCAGCTGGGAGGCCCTACCTAGT No data
Right 1052094683 9:24369766-24369788 TAGTGATGAGGAATGAGATAGGG No data
1052094677_1052094682 -5 Left 1052094677 9:24369747-24369769 CCAGCTGGGAGGCCCTACCTAGT No data
Right 1052094682 9:24369765-24369787 CTAGTGATGAGGAATGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052094677 Original CRISPR ACTAGGTAGGGCCTCCCAGC TGG (reversed) Intergenic
No off target data available for this crispr