ID: 1052100911

View in Genome Browser
Species Human (GRCh38)
Location 9:24445471-24445493
Sequence CAAGACCAACACTGAGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052100911_1052100914 -8 Left 1052100911 9:24445471-24445493 CCAAAGACTCAGTGTTGGTCTTG No data
Right 1052100914 9:24445486-24445508 TGGTCTTGGTTGTTGGCAGATGG No data
1052100911_1052100917 6 Left 1052100911 9:24445471-24445493 CCAAAGACTCAGTGTTGGTCTTG No data
Right 1052100917 9:24445500-24445522 GGCAGATGGGCATTCAGTGGTGG No data
1052100911_1052100916 3 Left 1052100911 9:24445471-24445493 CCAAAGACTCAGTGTTGGTCTTG No data
Right 1052100916 9:24445497-24445519 GTTGGCAGATGGGCATTCAGTGG No data
1052100911_1052100919 27 Left 1052100911 9:24445471-24445493 CCAAAGACTCAGTGTTGGTCTTG No data
Right 1052100919 9:24445521-24445543 GGCCATAGCCAGATTGGCCATGG No data
1052100911_1052100918 21 Left 1052100911 9:24445471-24445493 CCAAAGACTCAGTGTTGGTCTTG No data
Right 1052100918 9:24445515-24445537 AGTGGTGGCCATAGCCAGATTGG No data
1052100911_1052100915 -7 Left 1052100911 9:24445471-24445493 CCAAAGACTCAGTGTTGGTCTTG No data
Right 1052100915 9:24445487-24445509 GGTCTTGGTTGTTGGCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052100911 Original CRISPR CAAGACCAACACTGAGTCTT TGG (reversed) Intergenic
No off target data available for this crispr