ID: 1052100919

View in Genome Browser
Species Human (GRCh38)
Location 9:24445521-24445543
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052100911_1052100919 27 Left 1052100911 9:24445471-24445493 CCAAAGACTCAGTGTTGGTCTTG No data
Right 1052100919 9:24445521-24445543 GGCCATAGCCAGATTGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052100919 Original CRISPR GGCCATAGCCAGATTGGCCA TGG Intergenic
No off target data available for this crispr