ID: 1052104213

View in Genome Browser
Species Human (GRCh38)
Location 9:24492389-24492411
Sequence TTGGTCAGAGGTCCTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052104213_1052104217 -3 Left 1052104213 9:24492389-24492411 CCTCTTTTAGGACCTCTGACCAA No data
Right 1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG No data
1052104213_1052104215 -10 Left 1052104213 9:24492389-24492411 CCTCTTTTAGGACCTCTGACCAA No data
Right 1052104215 9:24492402-24492424 CTCTGACCAAAATCCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052104213 Original CRISPR TTGGTCAGAGGTCCTAAAAG AGG (reversed) Intergenic
No off target data available for this crispr