ID: 1052104217

View in Genome Browser
Species Human (GRCh38)
Location 9:24492409-24492431
Sequence CAAAATCCAAAGATGGAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052104213_1052104217 -3 Left 1052104213 9:24492389-24492411 CCTCTTTTAGGACCTCTGACCAA No data
Right 1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052104217 Original CRISPR CAAAATCCAAAGATGGAGCG AGG Intergenic
No off target data available for this crispr