ID: 1052104855

View in Genome Browser
Species Human (GRCh38)
Location 9:24500679-24500701
Sequence AACTGCTTATTGAAATCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052104852_1052104855 -3 Left 1052104852 9:24500659-24500681 CCACCTGTATTTGAAAGAATAAC No data
Right 1052104855 9:24500679-24500701 AACTGCTTATTGAAATCAGAGGG No data
1052104853_1052104855 -6 Left 1052104853 9:24500662-24500684 CCTGTATTTGAAAGAATAACTGC No data
Right 1052104855 9:24500679-24500701 AACTGCTTATTGAAATCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052104855 Original CRISPR AACTGCTTATTGAAATCAGA GGG Intergenic
No off target data available for this crispr