ID: 1052105887

View in Genome Browser
Species Human (GRCh38)
Location 9:24515384-24515406
Sequence GGAGTACTAATTCACTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052105887_1052105889 -4 Left 1052105887 9:24515384-24515406 CCCTTTGAGTGAATTAGTACTCC No data
Right 1052105889 9:24515403-24515425 CTCCTATAGCATTACCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052105887 Original CRISPR GGAGTACTAATTCACTCAAA GGG (reversed) Intergenic