ID: 1052105889

View in Genome Browser
Species Human (GRCh38)
Location 9:24515403-24515425
Sequence CTCCTATAGCATTACCTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052105888_1052105889 -5 Left 1052105888 9:24515385-24515407 CCTTTGAGTGAATTAGTACTCCT No data
Right 1052105889 9:24515403-24515425 CTCCTATAGCATTACCTGTATGG No data
1052105887_1052105889 -4 Left 1052105887 9:24515384-24515406 CCCTTTGAGTGAATTAGTACTCC No data
Right 1052105889 9:24515403-24515425 CTCCTATAGCATTACCTGTATGG No data
1052105886_1052105889 -3 Left 1052105886 9:24515383-24515405 CCCCTTTGAGTGAATTAGTACTC No data
Right 1052105889 9:24515403-24515425 CTCCTATAGCATTACCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052105889 Original CRISPR CTCCTATAGCATTACCTGTA TGG Intergenic
No off target data available for this crispr