ID: 1052106094

View in Genome Browser
Species Human (GRCh38)
Location 9:24518522-24518544
Sequence TTTGATTCACAAAGGCTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052106092_1052106094 15 Left 1052106092 9:24518484-24518506 CCATTTAAATGAATGTCTAGATA No data
Right 1052106094 9:24518522-24518544 TTTGATTCACAAAGGCTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052106094 Original CRISPR TTTGATTCACAAAGGCTTAT AGG Intergenic
No off target data available for this crispr