ID: 1052116022

View in Genome Browser
Species Human (GRCh38)
Location 9:24649213-24649235
Sequence GGCTGAGTCAAGGGTATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052116022_1052116028 16 Left 1052116022 9:24649213-24649235 CCATAAATACCCTTGACTCAGCC No data
Right 1052116028 9:24649252-24649274 CAGGACTACCAGCTACAGGAAGG 0: 2
1: 16
2: 12
3: 69
4: 257
1052116022_1052116027 12 Left 1052116022 9:24649213-24649235 CCATAAATACCCTTGACTCAGCC No data
Right 1052116027 9:24649248-24649270 ACATCAGGACTACCAGCTACAGG No data
1052116022_1052116025 -3 Left 1052116022 9:24649213-24649235 CCATAAATACCCTTGACTCAGCC No data
Right 1052116025 9:24649233-24649255 GCCAGACTCACACAGACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052116022 Original CRISPR GGCTGAGTCAAGGGTATTTA TGG (reversed) Intergenic
No off target data available for this crispr