ID: 1052120006

View in Genome Browser
Species Human (GRCh38)
Location 9:24702880-24702902
Sequence TTGGCTGCACCCACCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052120006_1052120013 22 Left 1052120006 9:24702880-24702902 CCATCCTGGGTGGGTGCAGCCAA No data
Right 1052120013 9:24702925-24702947 AAATTTCAAGTTGAGGGCTATGG No data
1052120006_1052120010 15 Left 1052120006 9:24702880-24702902 CCATCCTGGGTGGGTGCAGCCAA No data
Right 1052120010 9:24702918-24702940 CTCTTCCAAATTTCAAGTTGAGG No data
1052120006_1052120011 16 Left 1052120006 9:24702880-24702902 CCATCCTGGGTGGGTGCAGCCAA No data
Right 1052120011 9:24702919-24702941 TCTTCCAAATTTCAAGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052120006 Original CRISPR TTGGCTGCACCCACCCAGGA TGG (reversed) Intergenic
No off target data available for this crispr