ID: 1052120221

View in Genome Browser
Species Human (GRCh38)
Location 9:24705612-24705634
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052120212_1052120221 28 Left 1052120212 9:24705561-24705583 CCAAAAGAGAAAAATCTATTGAA No data
Right 1052120221 9:24705612-24705634 CTGGAGAATTGGGGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052120221 Original CRISPR CTGGAGAATTGGGGGGAAAT GGG Intergenic
No off target data available for this crispr