ID: 1052122054

View in Genome Browser
Species Human (GRCh38)
Location 9:24730407-24730429
Sequence CTCCATCACAAGTCCAACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052122054_1052122061 22 Left 1052122054 9:24730407-24730429 CCTTCGTTGGACTTGTGATGGAG No data
Right 1052122061 9:24730452-24730474 TGTGATTTATCCCTTGTGGGAGG No data
1052122054_1052122060 19 Left 1052122054 9:24730407-24730429 CCTTCGTTGGACTTGTGATGGAG No data
Right 1052122060 9:24730449-24730471 TGTTGTGATTTATCCCTTGTGGG No data
1052122054_1052122062 23 Left 1052122054 9:24730407-24730429 CCTTCGTTGGACTTGTGATGGAG No data
Right 1052122062 9:24730453-24730475 GTGATTTATCCCTTGTGGGAGGG No data
1052122054_1052122059 18 Left 1052122054 9:24730407-24730429 CCTTCGTTGGACTTGTGATGGAG No data
Right 1052122059 9:24730448-24730470 CTGTTGTGATTTATCCCTTGTGG No data
1052122054_1052122055 -6 Left 1052122054 9:24730407-24730429 CCTTCGTTGGACTTGTGATGGAG No data
Right 1052122055 9:24730424-24730446 ATGGAGTTGTCCCGTTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052122054 Original CRISPR CTCCATCACAAGTCCAACGA AGG (reversed) Intergenic
No off target data available for this crispr