ID: 1052125114

View in Genome Browser
Species Human (GRCh38)
Location 9:24765157-24765179
Sequence CAGGAAGTTCAAACTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052125114_1052125121 0 Left 1052125114 9:24765157-24765179 CCCTGCCCAGTTTGAACTTCCTG No data
Right 1052125121 9:24765180-24765202 GTGGCTTTGTTTACACTGTGAGG 0: 250
1: 389
2: 453
3: 265
4: 307
1052125114_1052125122 1 Left 1052125114 9:24765157-24765179 CCCTGCCCAGTTTGAACTTCCTG No data
Right 1052125122 9:24765181-24765203 TGGCTTTGTTTACACTGTGAGGG 0: 286
1: 395
2: 468
3: 268
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052125114 Original CRISPR CAGGAAGTTCAAACTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr