ID: 1052125753

View in Genome Browser
Species Human (GRCh38)
Location 9:24772748-24772770
Sequence ACACCCTGCTTCATAAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052125753_1052125756 15 Left 1052125753 9:24772748-24772770 CCAACCTTTATGAAGCAGGGTGT No data
Right 1052125756 9:24772786-24772808 TGTCCACAAAGTAGAGCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052125753 Original CRISPR ACACCCTGCTTCATAAAGGT TGG (reversed) Intergenic
No off target data available for this crispr