ID: 1052137353

View in Genome Browser
Species Human (GRCh38)
Location 9:24929538-24929560
Sequence AGGAATATGAATAAGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052137353_1052137357 26 Left 1052137353 9:24929538-24929560 CCATCTACCTTATTCATATTCCT No data
Right 1052137357 9:24929587-24929609 TTTGTGTCTATGTAGGCATATGG No data
1052137353_1052137358 27 Left 1052137353 9:24929538-24929560 CCATCTACCTTATTCATATTCCT No data
Right 1052137358 9:24929588-24929610 TTGTGTCTATGTAGGCATATGGG No data
1052137353_1052137356 19 Left 1052137353 9:24929538-24929560 CCATCTACCTTATTCATATTCCT No data
Right 1052137356 9:24929580-24929602 TTACGTGTTTGTGTCTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052137353 Original CRISPR AGGAATATGAATAAGGTAGA TGG (reversed) Intergenic
No off target data available for this crispr