ID: 1052137354 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:24929545-24929567 |
| Sequence | AAACTAGAGGAATATGAATA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1052137354_1052137357 | 19 | Left | 1052137354 | 9:24929545-24929567 | CCTTATTCATATTCCTCTAGTTT | No data | ||
| Right | 1052137357 | 9:24929587-24929609 | TTTGTGTCTATGTAGGCATATGG | No data | ||||
| 1052137354_1052137356 | 12 | Left | 1052137354 | 9:24929545-24929567 | CCTTATTCATATTCCTCTAGTTT | No data | ||
| Right | 1052137356 | 9:24929580-24929602 | TTACGTGTTTGTGTCTATGTAGG | No data | ||||
| 1052137354_1052137358 | 20 | Left | 1052137354 | 9:24929545-24929567 | CCTTATTCATATTCCTCTAGTTT | No data | ||
| Right | 1052137358 | 9:24929588-24929610 | TTGTGTCTATGTAGGCATATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1052137354 | Original CRISPR | AAACTAGAGGAATATGAATA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||