ID: 1052137355

View in Genome Browser
Species Human (GRCh38)
Location 9:24929558-24929580
Sequence AATAGTACAAGCAAAACTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052137355_1052137360 25 Left 1052137355 9:24929558-24929580 CCTCTAGTTTTGCTTGTACTATT No data
Right 1052137360 9:24929606-24929628 ATGGGTATGTATGTATGTGGTGG No data
1052137355_1052137361 26 Left 1052137355 9:24929558-24929580 CCTCTAGTTTTGCTTGTACTATT No data
Right 1052137361 9:24929607-24929629 TGGGTATGTATGTATGTGGTGGG No data
1052137355_1052137362 27 Left 1052137355 9:24929558-24929580 CCTCTAGTTTTGCTTGTACTATT No data
Right 1052137362 9:24929608-24929630 GGGTATGTATGTATGTGGTGGGG No data
1052137355_1052137363 28 Left 1052137355 9:24929558-24929580 CCTCTAGTTTTGCTTGTACTATT No data
Right 1052137363 9:24929609-24929631 GGTATGTATGTATGTGGTGGGGG No data
1052137355_1052137358 7 Left 1052137355 9:24929558-24929580 CCTCTAGTTTTGCTTGTACTATT No data
Right 1052137358 9:24929588-24929610 TTGTGTCTATGTAGGCATATGGG No data
1052137355_1052137357 6 Left 1052137355 9:24929558-24929580 CCTCTAGTTTTGCTTGTACTATT No data
Right 1052137357 9:24929587-24929609 TTTGTGTCTATGTAGGCATATGG No data
1052137355_1052137356 -1 Left 1052137355 9:24929558-24929580 CCTCTAGTTTTGCTTGTACTATT No data
Right 1052137356 9:24929580-24929602 TTACGTGTTTGTGTCTATGTAGG No data
1052137355_1052137359 22 Left 1052137355 9:24929558-24929580 CCTCTAGTTTTGCTTGTACTATT No data
Right 1052137359 9:24929603-24929625 CATATGGGTATGTATGTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052137355 Original CRISPR AATAGTACAAGCAAAACTAG AGG (reversed) Intergenic
No off target data available for this crispr