ID: 1052137356

View in Genome Browser
Species Human (GRCh38)
Location 9:24929580-24929602
Sequence TTACGTGTTTGTGTCTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052137354_1052137356 12 Left 1052137354 9:24929545-24929567 CCTTATTCATATTCCTCTAGTTT No data
Right 1052137356 9:24929580-24929602 TTACGTGTTTGTGTCTATGTAGG No data
1052137355_1052137356 -1 Left 1052137355 9:24929558-24929580 CCTCTAGTTTTGCTTGTACTATT No data
Right 1052137356 9:24929580-24929602 TTACGTGTTTGTGTCTATGTAGG No data
1052137353_1052137356 19 Left 1052137353 9:24929538-24929560 CCATCTACCTTATTCATATTCCT No data
Right 1052137356 9:24929580-24929602 TTACGTGTTTGTGTCTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052137356 Original CRISPR TTACGTGTTTGTGTCTATGT AGG Intergenic
No off target data available for this crispr