ID: 1052137357

View in Genome Browser
Species Human (GRCh38)
Location 9:24929587-24929609
Sequence TTTGTGTCTATGTAGGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052137355_1052137357 6 Left 1052137355 9:24929558-24929580 CCTCTAGTTTTGCTTGTACTATT No data
Right 1052137357 9:24929587-24929609 TTTGTGTCTATGTAGGCATATGG No data
1052137354_1052137357 19 Left 1052137354 9:24929545-24929567 CCTTATTCATATTCCTCTAGTTT No data
Right 1052137357 9:24929587-24929609 TTTGTGTCTATGTAGGCATATGG No data
1052137353_1052137357 26 Left 1052137353 9:24929538-24929560 CCATCTACCTTATTCATATTCCT No data
Right 1052137357 9:24929587-24929609 TTTGTGTCTATGTAGGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052137357 Original CRISPR TTTGTGTCTATGTAGGCATA TGG Intergenic
No off target data available for this crispr