ID: 1052138701

View in Genome Browser
Species Human (GRCh38)
Location 9:24949456-24949478
Sequence CAGTACATGCAGAAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052138697_1052138701 18 Left 1052138697 9:24949415-24949437 CCTCACATGGTCTTTCCTCTACG No data
Right 1052138701 9:24949456-24949478 CAGTACATGCAGAAAGTGGGAGG No data
1052138698_1052138701 3 Left 1052138698 9:24949430-24949452 CCTCTACGTGTGTGCATGCACAA No data
Right 1052138701 9:24949456-24949478 CAGTACATGCAGAAAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052138701 Original CRISPR CAGTACATGCAGAAAGTGGG AGG Intergenic
No off target data available for this crispr