ID: 1052144989

View in Genome Browser
Species Human (GRCh38)
Location 9:25037515-25037537
Sequence CAGCCCAGACAAGATGGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052144989_1052144992 5 Left 1052144989 9:25037515-25037537 CCTATGCCATCTTGTCTGGGCTG No data
Right 1052144992 9:25037543-25037565 TTGTGTTTGTTTTTTTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052144989 Original CRISPR CAGCCCAGACAAGATGGCAT AGG (reversed) Intergenic
No off target data available for this crispr