ID: 1052150517

View in Genome Browser
Species Human (GRCh38)
Location 9:25109304-25109326
Sequence TGTATCCTAGATCTCCTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052150512_1052150517 29 Left 1052150512 9:25109252-25109274 CCTCTTTGCATGTCAGCATCAAA No data
Right 1052150517 9:25109304-25109326 TGTATCCTAGATCTCCTAAGTGG No data
1052150514_1052150517 3 Left 1052150514 9:25109278-25109300 CCTTTCTTGTATTCTTGCTCCAA No data
Right 1052150517 9:25109304-25109326 TGTATCCTAGATCTCCTAAGTGG No data
1052150513_1052150517 4 Left 1052150513 9:25109277-25109299 CCCTTTCTTGTATTCTTGCTCCA No data
Right 1052150517 9:25109304-25109326 TGTATCCTAGATCTCCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052150517 Original CRISPR TGTATCCTAGATCTCCTAAG TGG Intergenic
No off target data available for this crispr