ID: 1052159608

View in Genome Browser
Species Human (GRCh38)
Location 9:25240712-25240734
Sequence CCATTTCCACTGGTGCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052159608_1052159613 11 Left 1052159608 9:25240712-25240734 CCCTGTAGCACCAGTGGAAATGG No data
Right 1052159613 9:25240746-25240768 TGTCACAACATTTAAGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052159608 Original CRISPR CCATTTCCACTGGTGCTACA GGG (reversed) Intergenic
No off target data available for this crispr