ID: 1052159760

View in Genome Browser
Species Human (GRCh38)
Location 9:25242804-25242826
Sequence TGTACCACACAAAAGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052159757_1052159760 14 Left 1052159757 9:25242767-25242789 CCTAATAAATGCAGGCATCAAAA No data
Right 1052159760 9:25242804-25242826 TGTACCACACAAAAGCTGGGAGG No data
1052159756_1052159760 18 Left 1052159756 9:25242763-25242785 CCAACCTAATAAATGCAGGCATC No data
Right 1052159760 9:25242804-25242826 TGTACCACACAAAAGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052159760 Original CRISPR TGTACCACACAAAAGCTGGG AGG Intergenic
No off target data available for this crispr