ID: 1052160284 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:25248911-25248933 |
Sequence | TCTGCTTGATGGTGTCCTAC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1052160284_1052160287 | -4 | Left | 1052160284 | 9:25248911-25248933 | CCTGTAGGACACCATCAAGCAGA | No data | ||
Right | 1052160287 | 9:25248930-25248952 | CAGACCAACATACACATTCTGGG | No data | ||||
1052160284_1052160291 | 25 | Left | 1052160284 | 9:25248911-25248933 | CCTGTAGGACACCATCAAGCAGA | No data | ||
Right | 1052160291 | 9:25248959-25248981 | AGAAGAAAAAATACAGAAAAAGG | No data | ||||
1052160284_1052160286 | -5 | Left | 1052160284 | 9:25248911-25248933 | CCTGTAGGACACCATCAAGCAGA | No data | ||
Right | 1052160286 | 9:25248929-25248951 | GCAGACCAACATACACATTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1052160284 | Original CRISPR | TCTGCTTGATGGTGTCCTAC AGG (reversed) | Intergenic | ||