ID: 1052160286

View in Genome Browser
Species Human (GRCh38)
Location 9:25248929-25248951
Sequence GCAGACCAACATACACATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052160284_1052160286 -5 Left 1052160284 9:25248911-25248933 CCTGTAGGACACCATCAAGCAGA No data
Right 1052160286 9:25248929-25248951 GCAGACCAACATACACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052160286 Original CRISPR GCAGACCAACATACACATTC TGG Intergenic
No off target data available for this crispr