ID: 1052161196

View in Genome Browser
Species Human (GRCh38)
Location 9:25262031-25262053
Sequence CTGCTACTTCCTTTGAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052161196_1052161197 5 Left 1052161196 9:25262031-25262053 CCATCACTCAAAGGAAGTAGCAG No data
Right 1052161197 9:25262059-25262081 TTGAAAGCTGAGAAGCTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052161196 Original CRISPR CTGCTACTTCCTTTGAGTGA TGG (reversed) Intergenic
No off target data available for this crispr