ID: 1052161509

View in Genome Browser
Species Human (GRCh38)
Location 9:25266148-25266170
Sequence ATTAAATCAAGTATCTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052161506_1052161509 28 Left 1052161506 9:25266097-25266119 CCTGTACTATTATTACAAAACTA No data
Right 1052161509 9:25266148-25266170 ATTAAATCAAGTATCTAGATTGG No data
1052161508_1052161509 -10 Left 1052161508 9:25266135-25266157 CCTAAGGTAGATAATTAAATCAA No data
Right 1052161509 9:25266148-25266170 ATTAAATCAAGTATCTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052161509 Original CRISPR ATTAAATCAAGTATCTAGAT TGG Intergenic
No off target data available for this crispr